other:Article Title: ALK upregulates POSTN and WNT signaling to drive neuroblastoma.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Gabby Miller Kids First Pediatric Research: Neuroblastoma dbGaP ID: phs001436 N/A Experimental models: Cell lines WTC11 iPSC Kreitzer et al., 201335 N/A 1323 iPSC Matsumoto et al., 201722 N/A Experimental models: Organisms/strains NOD.Cg-Prkdcscid II2rg/Szj Jackson Labs Cat#005557; RRID: IMSR_JAX:005557 Oligonucleotides FN1 sgRNA (GGCCGGCTGTGCTGCACAGG) Integrated DNA Technologies N/A POSTN sgRNA (GGAGAAAACATGGGTAAAAA) Integrated DNA Technologies N/A B3GAT1/HNK1 qPCR F (TCATCACTGTCTGGCACCAG) Integrated DNA Technologies N/A B3GAT1/HNK1 qPCR R (CAGACGTGCAGTACTCCCTG) Integrated DNA Technologies N/A GAPDH qPCR F (CCATGGGGAAGGTGAAGGTC) Integrated DNA Technologies N/A GAPDH qPCR R (TGAAGGGGTCATTGATGGCA) Integrated DNA Technologies N/A NGFR/p75 qPCR F (GTGAGTGCTGCAAAGCCTG) Integrated DNA Technologies N/A NGFR/p75 qPCR R (CTCACCACGTCGGAGAACG) Integrated DNA Technologies N/A SOX9 qPCR F (GACGCTGGGCAAGCTCT) Integrated DNA Technologies N/A SOX9 qPCR R (GTAATCCGGGTGGTCCTTCT) Integrated DNA Technologies N/A TFAP2A qPCR F (ACTCGGAGACCTCTCGATCC) Integrated DNA Technologies N/A TFAP2A qPCR R (GGACACGGGGCCTTTCTTAA) Integrated DNA Technologies N/A Recombinant DNA pCDH-CAG-3xFLAG-MYCN-P2A-mScarletT2A-Luciferase Huang et al., 201621 N/A pCDH-CAG-ALKF1174L-EF1a-puromycin This paper N/A pCDH-CAG-(empty)-EF1a-puromycin This paper N/A pCDH-UCOE-TRE3G-3xFLAG-MYCNP2A-mScarlet-CAG-rtta3G-P2ALuciferase-T2A-blasticidin This paper N/A pCDH-UCOE-TRE3G-mScarlet-CAGrtta3G-P2A- Luciferase-T2A-blasticidin This paper N/A pCDH-U6-control sgRNA-CAG-BFP This paper N/A pCDH-U6-POSTN sgRNA-CAG-BFP This paper N/A pCDH-U6-FN1 sgRNA-CAG-BFP This paper N/A pCDH-CAG-dCas9-BFP-KRAB This paper N/A Software and algorithms STAR aligner v2.7.2a Dobin A et al., 201336 https://github.com/alexdobin/STAR/ N/A RSEM v1.2.1 Li B et al., 201137 https://github.com/deweylab/RSEM N/A R R Core/R Foundation N/A RTsne (R Package) The Comprehensive R Archive Network (CRAN) N/A DESeq2 (R Package) Love MI et al., 201438 Bioconductor N/A EnrichR Chen EY et al., 201339 The Comprehensive R Archive Network (CRAN) N/A singscore Foroutan M et al., 201844 Bioconductor N/A Cell Reports 43, 113927, March 26, 2024 13
Article Title: Tissue-specific modifier alleles determine Mertk loss-of-function traits
Article Snippet: DOI: https://doi.org/10.7554/eLife.80530 15 of 27 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody Anti- MERTK (rabbit polyclonal) Abcam Cat# ab95925 WB (1:1000) Antibody Anti- TYRO3 (rabbit monoclonal) Cell Signaling Technology Cat# 5585S WB (1:1000) Antibody Anti-β-actin (rabbit monoclonal) Cell Signaling Technology Cat# 8457S WB (1:10,000) Antibody Anti-β-actin (mouse monoclonal) Cell Signaling Technology Cat# 3700S WB (1:10,000) Antibody Anti- rabbit IgG, IRDye800 (donkey polyclonal) Li- COR Biosciences Cat# 926- 32213 WB (1:15,000) Antibody Anti- mouse IgG, IRDye680 (donkey polyclonal) Li- COR Biosciences Cat# 926- 68072 WB (1:20,000) Antibody Anti- mouse CD16/32 (rat monoclonal) BioLegend Cat# 101302 FC (1:1000) Antibody Anti- mouse CD11b (rat monoclonal) BioLegend Cat# 101222 FC (1:200) Antibody Anti- mouse F4/80 (rat monoclonal) BioLegend Cat# 123114 FC (1:200) Antibody Anti- mouse MERTK (rat monoclonal) Invitrogen Cat# 17- 5751- 82 FC (1:200) Chemical compound, drug RNAprotect Cell Reagent QIAGEN Cat# 76526 Chemical compound, drug Paraformaldehyde 16% Electron Microscopy Sciences Cat# 15710 Chemical compound, drug Glutaraldehyde 25% Electron Microscopy Sciences Cat# 16200 Chemical compound, drug Tropicamide ophthalmic Solution 0.5% Sandoz Cat# 61214- 354- 01 Chemical compound, drug cOmplete Protease Inhibitor Cocktail Roche Cat# 11697498001 Chemical compound, drug Eye Fixative ServiceBio Cat# G1109 Commercial assay, kit RNeasy Plus Micro Kit QIAGEN Cat# 74034 Commercial assay, kit iScript cDNA Synthesis Kit Bio- Rad Cat# 1708891 Commercial assay, kit Mini- PROTEAN TGX Stain- Free Precast Gel Bio- Rad Cat# 4568025, 4568125 Commercial assay, kit Immun- Blot PVDF membrane Bio- Rad Cat#1620177 Commercial assay, kit Pierce BCA Protein Assay Kit Thermo Scientific Cat# 23227 Other Hematoxylin- eosin staining iHisto histopatholgy support https://www.ihisto.io/ Continued
Saline:Article Title: ALK upregulates POSTN and WNT signaling to drive neuroblastoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER (+)-sodium L-ascorbate Sigma Aldrich Cat#: A4034 10% Neutral Buffered Formalin Sigma Aldrich Cat#: R04586-84 10x Tris-buffered saline (TBS) Bio-Rad Cat#: 1706435 10x Tris/Glycine/SDS Bio-Rad Cat#: 1610772 2-Mercaptoethanol Thermo Fisher Scientific Cat#: 21985023 4x Laemmli Sample Buffer Bio-Rad Cat#: 1610747 Accutase Innovative Cell Technologies Cat#: AT 104-500 B-27 Supplement (50X), without vitamin A Thermo Fisher Scientific Cat#: 17504-044 Bovine Serum Albumin (BSA) Sigma-Aldrich Cat#: A4612-1G Clarity Western ECL Substrate Bio-Rad Cat#: 1705061 Dulbecco’s phosphate-buffered saline (DPBS), no calcium, no magnesium Thermo Fisher Scientific Cat#: 14190144 Ethyl alcohol, Pure Sigma-Aldrich Cat#: E7023 EveryBlot Blocking Buffer Bio-Rad Cat#: 12010020 Fluoromount-GTM Mounting Medium, with DAPI Thermo Fisher Scientific Cat#: 00-4959-52 HaltTM Protease and Phosphatase Inhibitor Single-Use Cocktail (100X) Thermo Fisher Scientific Cat#: 78446 Heregulin b-1 Peprotech Cat#: 100-03 Mini-PROTEAN TGX Stain-Free Precast Gel Bio-Rad Cat#: 4568095 mTeSRTM1 StemCell technologies Cat#: 85850 N-2 Supplement (100X) Thermo Fisher Scientific Cat#: 17502048 NeurobasalTM-A Medium Thermo Fisher Scientific Cat#: 10888022 Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific Cat#: 15140122 PierceTM RIPA buffer Thermo Fisher Scientific Cat#: 89901 Retinoic acid Sigma-Aldrich Cat#: R2625 SsoAdvanced Universal SYBR Green Supermix Bio-Rad Cat#: 1725271 SuperScriptTM VILOTM Master Mix Thermo Fisher Scientific Cat#: 11755250 Trans-Blot Turbo 5x Transfer Buffer Bio-Rad Cat#: 10026938 Triton X-100 Sigma-Aldrich Cat#: X100 ATP (10mM) New England Biolabs Cat# P0756L T7 DNA ligase New England Biolabs Cat# M0318L T4 PNK New England Biolabs Cat# M0201L T4 ligase New England Biolabs Cat# M0202L Bbsi enzyme New England Biolabs Cat# R0539L DTT (1M) Thermo Fisher Scientific Cat# P2325 FastDigest Buffer (10x) Thermo Fisher Scientific Cat# B64 Critical commercial assays Quick RNA Miniprep Kit Zymo Research Cat#: 11-328 PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat#: 23225 Click-iTTM Plus EdU Alexa FluorTM 647 Flow Cytometry Assay Kit Thermo Fisher Scientific Cat#: C10635 Zyppy Plasmid Miniprep Kit Zymo Research Cat# D4037 Deposited data MYCN and ALK driven iPSC-basedtNCCs genomic data GEO: GSE228194 N/A Treehouse Childhood Cancer Initiative Compendium RNA-seq GEO: GSE129326 N/A TARGET Neuroblastoma datasets dbGaP ID: phs000467 N/A (Continued on next page) 12 Cell Reports 43, 113927, March 26, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Gabby Miller Kids First Pediatric Research: Neuroblastoma dbGaP ID: phs001436 N/A Experimental models: Cell lines WTC11 iPSC Kreitzer et al., 201335 N/A 1323 iPSC Matsumoto et al., 201722 N/A Experimental models: Organisms/strains NOD.Cg-Prkdcscid II2rg/Szj Jackson Labs Cat#005557; RRID: IMSR_JAX:005557 Oligonucleotides FN1 sgRNA (GGCCGGCTGTGCTGCACAGG) Integrated DNA Technologies N/A POSTN sgRNA (GGAGAAAACATGGGTAAAAA) Integrated DNA Technologies N/A B3GAT1/HNK1 qPCR F (TCATCACTGTCTGGCACCAG) Integrated DNA Technologies N/A B3GAT1/HNK1 qPCR R (CAGACGTGCAGTACTCCCTG) Integrated DNA Technologies N/A GAPDH qPCR F (CCATGGGGAAGGTGAAGGTC) Integrated DNA Technologies N/A GAPDH qPCR R (TGAAGGGGTCATTGATGGCA) Integrated DNA Technologies N/A NGFR/p75 qPCR F (GTGAGTGCTGCAAAGCCTG) Integrated DNA Technologies N/A NGFR/p75 qPCR R (CTCACCACGTCGGAGAACG) Integrated DNA Technologies N/A SOX9 qPCR F (GACGCTGGGCAAGCTCT) Integrated DNA Technologies N/A SOX9 qPCR R (GTAATCCGGGTGGTCCTTCT) Integrated DNA Technologies N/A TFAP2A qPCR F (ACTCGGAGACCTCTCGATCC) Integrated DNA Technologies N/A TFAP2A qPCR R (GGACACGGGGCCTTTCTTAA) Integrated DNA Technologies N/A Recombinant DNA pCDH-CAG-3xFLAG-MYCN-P2A-mScarletT2A-Luciferase Huang et al., 201621 N/A pCDH-CAG-ALKF1174L-EF1a-puromycin This paper N/A pCDH-CAG-(empty)-EF1a-puromycin This paper N/A pCDH-UCOE-TRE3G-3xFLAG-MYCNP2A-mScarlet-CAG-rtta3G-P2ALuciferase-T2A-blasticidin This paper N/A pCDH-UCOE-TRE3G-mScarlet-CAGrtta3G-P2A- Luciferase-T2A-blasticidin This paper N/A pCDH-U6-control sgRNA-CAG-BFP This paper N/A pCDH-U6-POSTN sgRNA-CAG-BFP This paper N/A pCDH-U6-FN1 sgRNA-CAG-BFP This paper N/A pCDH-CAG-dCas9-BFP-KRAB This paper N/A Software and algorithms STAR aligner v2.7.2a Dobin A et al., 201336 https://github.com/alexdobin/STAR/ N/A RSEM v1.2.1 Li B et al., 201137 https://github.com/deweylab/RSEM N/A R R Core/R Foundation N/A RTsne (R Package) The Comprehensive R Archive Network (CRAN) N/A DESeq2 (R Package) Love MI et al., 201438 Bioconductor N/A EnrichR Chen EY et al., 201339 The Comprehensive R Archive Network (CRAN) N/A singscore Foroutan M et al., 201844 Bioconductor N/A Cell Reports 43, 113927, March 26, 2024 13
Western Blot:Article Title: ALK upregulates POSTN and WNT signaling to drive neuroblastoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER (+)-sodium L-ascorbate Sigma Aldrich Cat#: A4034 10% Neutral Buffered Formalin Sigma Aldrich Cat#: R04586-84 10x Tris-buffered saline (TBS) Bio-Rad Cat#: 1706435 10x Tris/Glycine/SDS Bio-Rad Cat#: 1610772 2-Mercaptoethanol Thermo Fisher Scientific Cat#: 21985023 4x Laemmli Sample Buffer Bio-Rad Cat#: 1610747 Accutase Innovative Cell Technologies Cat#: AT 104-500 B-27 Supplement (50X), without vitamin A Thermo Fisher Scientific Cat#: 17504-044 Bovine Serum Albumin (BSA) Sigma-Aldrich Cat#: A4612-1G Clarity Western ECL Substrate Bio-Rad Cat#: 1705061 Dulbecco’s phosphate-buffered saline (DPBS), no calcium, no magnesium Thermo Fisher Scientific Cat#: 14190144 Ethyl alcohol, Pure Sigma-Aldrich Cat#: E7023 EveryBlot Blocking Buffer Bio-Rad Cat#: 12010020 Fluoromount-GTM Mounting Medium, with DAPI Thermo Fisher Scientific Cat#: 00-4959-52 HaltTM Protease and Phosphatase Inhibitor Single-Use Cocktail (100X) Thermo Fisher Scientific Cat#: 78446 Heregulin b-1 Peprotech Cat#: 100-03 Mini-PROTEAN TGX Stain-Free Precast Gel Bio-Rad Cat#: 4568095 mTeSRTM1 StemCell technologies Cat#: 85850 N-2 Supplement (100X) Thermo Fisher Scientific Cat#: 17502048 NeurobasalTM-A Medium Thermo Fisher Scientific Cat#: 10888022 Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific Cat#: 15140122 PierceTM RIPA buffer Thermo Fisher Scientific Cat#: 89901 Retinoic acid Sigma-Aldrich Cat#: R2625 SsoAdvanced Universal SYBR Green Supermix Bio-Rad Cat#: 1725271 SuperScriptTM VILOTM Master Mix Thermo Fisher Scientific Cat#: 11755250 Trans-Blot Turbo 5x Transfer Buffer Bio-Rad Cat#: 10026938 Triton X-100 Sigma-Aldrich Cat#: X100 ATP (10mM) New England Biolabs Cat# P0756L T7 DNA ligase New England Biolabs Cat# M0318L T4 PNK New England Biolabs Cat# M0201L T4 ligase New England Biolabs Cat# M0202L Bbsi enzyme New England Biolabs Cat# R0539L DTT (1M) Thermo Fisher Scientific Cat# P2325 FastDigest Buffer (10x) Thermo Fisher Scientific Cat# B64 Critical commercial assays Quick RNA Miniprep Kit Zymo Research Cat#: 11-328 PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat#: 23225 Click-iTTM Plus EdU Alexa FluorTM 647 Flow Cytometry Assay Kit Thermo Fisher Scientific Cat#: C10635 Zyppy Plasmid Miniprep Kit Zymo Research Cat# D4037 Deposited data MYCN and ALK driven iPSC-basedtNCCs genomic data GEO: GSE228194 N/A Treehouse Childhood Cancer Initiative Compendium RNA-seq GEO: GSE129326 N/A TARGET Neuroblastoma datasets dbGaP ID: phs000467 N/A (Continued on next page) 12 Cell Reports 43, 113927, March 26, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Gabby Miller Kids First Pediatric Research: Neuroblastoma dbGaP ID: phs001436 N/A Experimental models: Cell lines WTC11 iPSC Kreitzer et al., 201335 N/A 1323 iPSC Matsumoto et al., 201722 N/A Experimental models: Organisms/strains NOD.Cg-Prkdcscid II2rg/Szj Jackson Labs Cat#005557; RRID: IMSR_JAX:005557 Oligonucleotides FN1 sgRNA (GGCCGGCTGTGCTGCACAGG) Integrated DNA Technologies N/A POSTN sgRNA (GGAGAAAACATGGGTAAAAA) Integrated DNA Technologies N/A B3GAT1/HNK1 qPCR F (TCATCACTGTCTGGCACCAG) Integrated DNA Technologies N/A B3GAT1/HNK1 qPCR R (CAGACGTGCAGTACTCCCTG) Integrated DNA Technologies N/A GAPDH qPCR F (CCATGGGGAAGGTGAAGGTC) Integrated DNA Technologies N/A GAPDH qPCR R (TGAAGGGGTCATTGATGGCA) Integrated DNA Technologies N/A NGFR/p75 qPCR F (GTGAGTGCTGCAAAGCCTG) Integrated DNA Technologies N/A NGFR/p75 qPCR R (CTCACCACGTCGGAGAACG) Integrated DNA Technologies N/A SOX9 qPCR F (GACGCTGGGCAAGCTCT) Integrated DNA Technologies N/A SOX9 qPCR R (GTAATCCGGGTGGTCCTTCT) Integrated DNA Technologies N/A TFAP2A qPCR F (ACTCGGAGACCTCTCGATCC) Integrated DNA Technologies N/A TFAP2A qPCR R (GGACACGGGGCCTTTCTTAA) Integrated DNA Technologies N/A Recombinant DNA pCDH-CAG-3xFLAG-MYCN-P2A-mScarletT2A-Luciferase Huang et al., 201621 N/A pCDH-CAG-ALKF1174L-EF1a-puromycin This paper N/A pCDH-CAG-(empty)-EF1a-puromycin This paper N/A pCDH-UCOE-TRE3G-3xFLAG-MYCNP2A-mScarlet-CAG-rtta3G-P2ALuciferase-T2A-blasticidin This paper N/A pCDH-UCOE-TRE3G-mScarlet-CAGrtta3G-P2A- Luciferase-T2A-blasticidin This paper N/A pCDH-U6-control sgRNA-CAG-BFP This paper N/A pCDH-U6-POSTN sgRNA-CAG-BFP This paper N/A pCDH-U6-FN1 sgRNA-CAG-BFP This paper N/A pCDH-CAG-dCas9-BFP-KRAB This paper N/A Software and algorithms STAR aligner v2.7.2a Dobin A et al., 201336 https://github.com/alexdobin/STAR/ N/A RSEM v1.2.1 Li B et al., 201137 https://github.com/deweylab/RSEM N/A R R Core/R Foundation N/A RTsne (R Package) The Comprehensive R Archive Network (CRAN) N/A DESeq2 (R Package) Love MI et al., 201438 Bioconductor N/A EnrichR Chen EY et al., 201339 The Comprehensive R Archive Network (CRAN) N/A singscore Foroutan M et al., 201844 Bioconductor N/A Cell Reports 43, 113927, March 26, 2024 13
Article Title: Rhinovirus triggers distinct host responses through differential engagement of epithelial innate immune signaling
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-human Gasdermin D (E5O4N) Cell Signaling Cat# 69469; RRID:AB_3697916 Sheep polyclonal anti-human NLRP1 R&D System Cat# AF6788; RRID:AB_10891878 Mouse monoclonal anti-human β-Actin (C4) Santa Cruz Cat# sc-47778; RRID:AB_626632 Goat anti-rabbit IgG Jackson ImmunoResearch Cat# 111-035-003; RRID:AB_2313567 Rabbit anti-sheep IgG ThermoFisher Cat# 31480; RRID:AB_228457 Goat anti-mouse IgG Jackson ImmunoResearch Cat# 115-035-003; RRID:AB_10015289 Mouse monoclonal anti-rhinovirus 16 (R16-7) QED Bioscience Cat# 18578; RRID:AB_3720294 Bacterial and virus strains Rhinovirus A1 ATCC Cat# VR-1559 psPAX2 Didier Trono Lab Cat# 12260; RRID:Addgene_12260 pMD2.G Didier Trono Lab Cat# 12259; RRID:Addgene_12259 lentiCRISPRv2GFP Walter et al.82 Cat# 82416; RRID:Addgene 82416 Biological samples Nasal mucosal surgical tissue Yale Tissue Procurement Service; https://medicine.yale.edu/ pathology/research/ypts/ N/A Chemicals, peptides, and recombinant proteins BX-795 Cayman Chemical Cat# 14932 TPCA-1 Cayman Chemical Cat# 15115 Ruxolitinib Cayman Chemical Cat# 11609 PneumaCult-Ex Plus Medium Stemcell Technologies Cat# 05040 PneumaCult-ALI Medium Stemcell Technologies Cat# 05001 BEGM Bronchial Epithelial Cell Growth Medium Lonza Cat# CC-3170 Opti-MEM Reduced Serum Medium Gibco Cat# 31985-070 DMEM, high glucose Gibco Cat# 11965-092 Human Recombinant IFN-β PBL Assay Science Cat# 11415 Human Recombinant IFN-λ1 R&D System Cat# 1598-IL Human Recombinant IL-1β PeproTech Cat# 200-01B QUANTI-Blue solution InvivoGen Cat# rep-qbs Ac-YVAD-CMK Cayman Chemical Cat# 10014 ZVAD(OMe)-CMK Cayman Chemical Cat# 14463 Disulfiram Cayman Chemical Cat# 15303 Rupintrivir (AG-7088) Sigma Aldrich Cat# PZ0315 MK-0608 Sigma Aldrich Cat# SML3200 Val-boroPro (talabostat) Millipore Sigma Cat# 53-146-50001 DharmaFECT transfection reagent Horizon Discovery Cat# T-2005-01 Glycine, Free Base RPI Research Products Cat# G36050 Pierce RIPA Buffer Thermo Scientific Cat# 89900 PhosSTOP Roche Cat# 04906845001 cOmplete Mini Protease Inhibitor Cocktail Roche Cat# 11697498001 Mini-PROTEAN TGX-Stain-Free Precast Gel Bio-Rad Cat# 4568084 EveryBlot Blocking Buffer Bio-Rad Cat# 12010020 TrypLE Express Enzyme Gibco Cat# 12604013 Polybrene Millipore Sigma Cat# TR-1003-G Clarity Western ECL substrate Bio-Rad Cat# 170-5061 (Continued on next page) e1 Cell Press Blue 1, 100001, February 1, 2026 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Aurum Total RNA Mini Kit Bio-Rad Cat# 7326820 iScript cDNA synthesis kit Bio-Rad Cat# 1708891 SYBR Green iTaq Universal mix Bio-Rad Cat# 1725124 LDH Cytotoxicity Assay Kit Cayman Chemical Cat# 610070 Evercode Whole Transcriptome Parse Biosciences https://www.parsebiosciences.com/ products/evercode-wt/ KAPA mRNA HyperPrep kit Roche Cat# 08098115702 Human CXCL10 DuoSet ELISA R&D Systems Cat# DY-266 Human IFN-λ1 DuoSet ELISA R&D Systems Cat# DY-7246 Human IL-1α DuoSet ELISA R&D Systems Cat# DY-200 Human IL-1β DuoSet ELISA R&D Systems Cat# DY-201 Human CXCL5 DuoSet ELISA R&D Systems Cat# DY-254 Human CXCL8 DuoSet ELISA R&D Systems Cat# DY-208 Human Cytokine/Chemokine 71-Plex Discovery Assay Eve Technologies Cat# HD-71 Pierce BCA Protein Assay Kit Thermo Scientific Cat# 23225 Deposited data Code and metadata to reproduce the scRNA-seq analysis This paper Mendeley data: 10.17632/2z5v5mvy4m.1 Rhinovirus A1 genome Genbank https://www.ncbi.nlm.nih.gov/ nuccore/KC894166.1 scRNASeq of HNEC ALI RV infection with BX795 This paper dbGAP:phs004417.v1.p1 Bulk RNA Seq of HNEC ALI RV infection with BX795 and TPCA1 This paper dbGAP:phs004417.v1.p1 scRNASeq of airway brushing from adult COVID19 patients Yoshida et al.83 https://www.covid19cellatlas.org/ Experimental models: Cell lines Primary Human Nasal Epithelial Cells Promocell Cat# 12620; H1 HeLa ATCC Cat# CRL-1958; HEK-Blue IFN-α/β reporter cells InvivoGen Cat# hkb-ifnabv2; RRID:CVCL_E8DB HEK-Blue IFN-λ reporter cells InvivoGen Cat# hbk-ifnlv2 HEK-Blue IL-1 reporter cells InvivoGen Cat# hkb-il1bv2; RRID:CVCL_E8DC Immortalized human bronchial epithelial cell BCi-NS1.1 Walter et al.63 RRID:CVCL_T029 HEK293T Abcam Cat# ab282205; RRID:CVCL_0063 Oligonucleotides qPCR primers: see Table S5 Yale Keck Oligonucleotide; https://medicine.yale.edu/ keck/oligo/ N/A Dharmacon siGENOME siRNA: see Table S5 Horizon Discovery N/A sgRNA for CRISPR KO: sequence see Table S5 Yale Keck Oligonucleotide N/A Software and algorithms Trailmaker (split pipe v0.9.6) Parse Biosciences RRID:SCR_026736 R v4.4.1 R Project for Statistical Computing RRID:SCR_001905 Seurat v4 Butler et al.84 RRID:SCR_016341 Slingshot 2.14.0 Street et al.85 RRID:SCR_017012 CellChat 2.1.2 Jin et al.44 RRID:SCR_021946 Ingenuity Pathway Analysis QIAGEN RRID:SCR_008653 Cytoscape Shannon et al.86 RRID:SCR_003022 iRegulon Janky et al.39 http://iregulon.aertslab.org/ (Continued on next page) Cell Press Blue 1, 100001, February 1, 2026 e2 Article ll OPEN ACCESS
Blocking Assay:Article Title: ALK upregulates POSTN and WNT signaling to drive neuroblastoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER (+)-sodium L-ascorbate Sigma Aldrich Cat#: A4034 10% Neutral Buffered Formalin Sigma Aldrich Cat#: R04586-84 10x Tris-buffered saline (TBS) Bio-Rad Cat#: 1706435 10x Tris/Glycine/SDS Bio-Rad Cat#: 1610772 2-Mercaptoethanol Thermo Fisher Scientific Cat#: 21985023 4x Laemmli Sample Buffer Bio-Rad Cat#: 1610747 Accutase Innovative Cell Technologies Cat#: AT 104-500 B-27 Supplement (50X), without vitamin A Thermo Fisher Scientific Cat#: 17504-044 Bovine Serum Albumin (BSA) Sigma-Aldrich Cat#: A4612-1G Clarity Western ECL Substrate Bio-Rad Cat#: 1705061 Dulbecco’s phosphate-buffered saline (DPBS), no calcium, no magnesium Thermo Fisher Scientific Cat#: 14190144 Ethyl alcohol, Pure Sigma-Aldrich Cat#: E7023 EveryBlot Blocking Buffer Bio-Rad Cat#: 12010020 Fluoromount-GTM Mounting Medium, with DAPI Thermo Fisher Scientific Cat#: 00-4959-52 HaltTM Protease and Phosphatase Inhibitor Single-Use Cocktail (100X) Thermo Fisher Scientific Cat#: 78446 Heregulin b-1 Peprotech Cat#: 100-03 Mini-PROTEAN TGX Stain-Free Precast Gel Bio-Rad Cat#: 4568095 mTeSRTM1 StemCell technologies Cat#: 85850 N-2 Supplement (100X) Thermo Fisher Scientific Cat#: 17502048 NeurobasalTM-A Medium Thermo Fisher Scientific Cat#: 10888022 Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific Cat#: 15140122 PierceTM RIPA buffer Thermo Fisher Scientific Cat#: 89901 Retinoic acid Sigma-Aldrich Cat#: R2625 SsoAdvanced Universal SYBR Green Supermix Bio-Rad Cat#: 1725271 SuperScriptTM VILOTM Master Mix Thermo Fisher Scientific Cat#: 11755250 Trans-Blot Turbo 5x Transfer Buffer Bio-Rad Cat#: 10026938 Triton X-100 Sigma-Aldrich Cat#: X100 ATP (10mM) New England Biolabs Cat# P0756L T7 DNA ligase New England Biolabs Cat# M0318L T4 PNK New England Biolabs Cat# M0201L T4 ligase New England Biolabs Cat# M0202L Bbsi enzyme New England Biolabs Cat# R0539L DTT (1M) Thermo Fisher Scientific Cat# P2325 FastDigest Buffer (10x) Thermo Fisher Scientific Cat# B64 Critical commercial assays Quick RNA Miniprep Kit Zymo Research Cat#: 11-328 PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat#: 23225 Click-iTTM Plus EdU Alexa FluorTM 647 Flow Cytometry Assay Kit Thermo Fisher Scientific Cat#: C10635 Zyppy Plasmid Miniprep Kit Zymo Research Cat# D4037 Deposited data MYCN and ALK driven iPSC-basedtNCCs genomic data GEO: GSE228194 N/A Treehouse Childhood Cancer Initiative Compendium RNA-seq GEO: GSE129326 N/A TARGET Neuroblastoma datasets dbGaP ID: phs000467 N/A (Continued on next page) 12 Cell Reports 43, 113927, March 26, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Gabby Miller Kids First Pediatric Research: Neuroblastoma dbGaP ID: phs001436 N/A Experimental models: Cell lines WTC11 iPSC Kreitzer et al., 201335 N/A 1323 iPSC Matsumoto et al., 201722 N/A Experimental models: Organisms/strains NOD.Cg-Prkdcscid II2rg/Szj Jackson Labs Cat#005557; RRID: IMSR_JAX:005557 Oligonucleotides FN1 sgRNA (GGCCGGCTGTGCTGCACAGG) Integrated DNA Technologies N/A POSTN sgRNA (GGAGAAAACATGGGTAAAAA) Integrated DNA Technologies N/A B3GAT1/HNK1 qPCR F (TCATCACTGTCTGGCACCAG) Integrated DNA Technologies N/A B3GAT1/HNK1 qPCR R (CAGACGTGCAGTACTCCCTG) Integrated DNA Technologies N/A GAPDH qPCR F (CCATGGGGAAGGTGAAGGTC) Integrated DNA Technologies N/A GAPDH qPCR R (TGAAGGGGTCATTGATGGCA) Integrated DNA Technologies N/A NGFR/p75 qPCR F (GTGAGTGCTGCAAAGCCTG) Integrated DNA Technologies N/A NGFR/p75 qPCR R (CTCACCACGTCGGAGAACG) Integrated DNA Technologies N/A SOX9 qPCR F (GACGCTGGGCAAGCTCT) Integrated DNA Technologies N/A SOX9 qPCR R (GTAATCCGGGTGGTCCTTCT) Integrated DNA Technologies N/A TFAP2A qPCR F (ACTCGGAGACCTCTCGATCC) Integrated DNA Technologies N/A TFAP2A qPCR R (GGACACGGGGCCTTTCTTAA) Integrated DNA Technologies N/A Recombinant DNA pCDH-CAG-3xFLAG-MYCN-P2A-mScarletT2A-Luciferase Huang et al., 201621 N/A pCDH-CAG-ALKF1174L-EF1a-puromycin This paper N/A pCDH-CAG-(empty)-EF1a-puromycin This paper N/A pCDH-UCOE-TRE3G-3xFLAG-MYCNP2A-mScarlet-CAG-rtta3G-P2ALuciferase-T2A-blasticidin This paper N/A pCDH-UCOE-TRE3G-mScarlet-CAGrtta3G-P2A- Luciferase-T2A-blasticidin This paper N/A pCDH-U6-control sgRNA-CAG-BFP This paper N/A pCDH-U6-POSTN sgRNA-CAG-BFP This paper N/A pCDH-U6-FN1 sgRNA-CAG-BFP This paper N/A pCDH-CAG-dCas9-BFP-KRAB This paper N/A Software and algorithms STAR aligner v2.7.2a Dobin A et al., 201336 https://github.com/alexdobin/STAR/ N/A RSEM v1.2.1 Li B et al., 201137 https://github.com/deweylab/RSEM N/A R R Core/R Foundation N/A RTsne (R Package) The Comprehensive R Archive Network (CRAN) N/A DESeq2 (R Package) Love MI et al., 201438 Bioconductor N/A EnrichR Chen EY et al., 201339 The Comprehensive R Archive Network (CRAN) N/A singscore Foroutan M et al., 201844 Bioconductor N/A Cell Reports 43, 113927, March 26, 2024 13
Article Title: Rhinovirus triggers distinct host responses through differential engagement of epithelial innate immune signaling
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-human Gasdermin D (E5O4N) Cell Signaling Cat# 69469; RRID:AB_3697916 Sheep polyclonal anti-human NLRP1 R&D System Cat# AF6788; RRID:AB_10891878 Mouse monoclonal anti-human β-Actin (C4) Santa Cruz Cat# sc-47778; RRID:AB_626632 Goat anti-rabbit IgG Jackson ImmunoResearch Cat# 111-035-003; RRID:AB_2313567 Rabbit anti-sheep IgG ThermoFisher Cat# 31480; RRID:AB_228457 Goat anti-mouse IgG Jackson ImmunoResearch Cat# 115-035-003; RRID:AB_10015289 Mouse monoclonal anti-rhinovirus 16 (R16-7) QED Bioscience Cat# 18578; RRID:AB_3720294 Bacterial and virus strains Rhinovirus A1 ATCC Cat# VR-1559 psPAX2 Didier Trono Lab Cat# 12260; RRID:Addgene_12260 pMD2.G Didier Trono Lab Cat# 12259; RRID:Addgene_12259 lentiCRISPRv2GFP Walter et al.82 Cat# 82416; RRID:Addgene 82416 Biological samples Nasal mucosal surgical tissue Yale Tissue Procurement Service; https://medicine.yale.edu/ pathology/research/ypts/ N/A Chemicals, peptides, and recombinant proteins BX-795 Cayman Chemical Cat# 14932 TPCA-1 Cayman Chemical Cat# 15115 Ruxolitinib Cayman Chemical Cat# 11609 PneumaCult-Ex Plus Medium Stemcell Technologies Cat# 05040 PneumaCult-ALI Medium Stemcell Technologies Cat# 05001 BEGM Bronchial Epithelial Cell Growth Medium Lonza Cat# CC-3170 Opti-MEM Reduced Serum Medium Gibco Cat# 31985-070 DMEM, high glucose Gibco Cat# 11965-092 Human Recombinant IFN-β PBL Assay Science Cat# 11415 Human Recombinant IFN-λ1 R&D System Cat# 1598-IL Human Recombinant IL-1β PeproTech Cat# 200-01B QUANTI-Blue solution InvivoGen Cat# rep-qbs Ac-YVAD-CMK Cayman Chemical Cat# 10014 ZVAD(OMe)-CMK Cayman Chemical Cat# 14463 Disulfiram Cayman Chemical Cat# 15303 Rupintrivir (AG-7088) Sigma Aldrich Cat# PZ0315 MK-0608 Sigma Aldrich Cat# SML3200 Val-boroPro (talabostat) Millipore Sigma Cat# 53-146-50001 DharmaFECT transfection reagent Horizon Discovery Cat# T-2005-01 Glycine, Free Base RPI Research Products Cat# G36050 Pierce RIPA Buffer Thermo Scientific Cat# 89900 PhosSTOP Roche Cat# 04906845001 cOmplete Mini Protease Inhibitor Cocktail Roche Cat# 11697498001 Mini-PROTEAN TGX-Stain-Free Precast Gel Bio-Rad Cat# 4568084 EveryBlot Blocking Buffer Bio-Rad Cat# 12010020 TrypLE Express Enzyme Gibco Cat# 12604013 Polybrene Millipore Sigma Cat# TR-1003-G Clarity Western ECL substrate Bio-Rad Cat# 170-5061 (Continued on next page) e1 Cell Press Blue 1, 100001, February 1, 2026 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Aurum Total RNA Mini Kit Bio-Rad Cat# 7326820 iScript cDNA synthesis kit Bio-Rad Cat# 1708891 SYBR Green iTaq Universal mix Bio-Rad Cat# 1725124 LDH Cytotoxicity Assay Kit Cayman Chemical Cat# 610070 Evercode Whole Transcriptome Parse Biosciences https://www.parsebiosciences.com/ products/evercode-wt/ KAPA mRNA HyperPrep kit Roche Cat# 08098115702 Human CXCL10 DuoSet ELISA R&D Systems Cat# DY-266 Human IFN-λ1 DuoSet ELISA R&D Systems Cat# DY-7246 Human IL-1α DuoSet ELISA R&D Systems Cat# DY-200 Human IL-1β DuoSet ELISA R&D Systems Cat# DY-201 Human CXCL5 DuoSet ELISA R&D Systems Cat# DY-254 Human CXCL8 DuoSet ELISA R&D Systems Cat# DY-208 Human Cytokine/Chemokine 71-Plex Discovery Assay Eve Technologies Cat# HD-71 Pierce BCA Protein Assay Kit Thermo Scientific Cat# 23225 Deposited data Code and metadata to reproduce the scRNA-seq analysis This paper Mendeley data: 10.17632/2z5v5mvy4m.1 Rhinovirus A1 genome Genbank https://www.ncbi.nlm.nih.gov/ nuccore/KC894166.1 scRNASeq of HNEC ALI RV infection with BX795 This paper dbGAP:phs004417.v1.p1 Bulk RNA Seq of HNEC ALI RV infection with BX795 and TPCA1 This paper dbGAP:phs004417.v1.p1 scRNASeq of airway brushing from adult COVID19 patients Yoshida et al.83 https://www.covid19cellatlas.org/ Experimental models: Cell lines Primary Human Nasal Epithelial Cells Promocell Cat# 12620; H1 HeLa ATCC Cat# CRL-1958; HEK-Blue IFN-α/β reporter cells InvivoGen Cat# hkb-ifnabv2; RRID:CVCL_E8DB HEK-Blue IFN-λ reporter cells InvivoGen Cat# hbk-ifnlv2 HEK-Blue IL-1 reporter cells InvivoGen Cat# hkb-il1bv2; RRID:CVCL_E8DC Immortalized human bronchial epithelial cell BCi-NS1.1 Walter et al.63 RRID:CVCL_T029 HEK293T Abcam Cat# ab282205; RRID:CVCL_0063 Oligonucleotides qPCR primers: see Table S5 Yale Keck Oligonucleotide; https://medicine.yale.edu/ keck/oligo/ N/A Dharmacon siGENOME siRNA: see Table S5 Horizon Discovery N/A sgRNA for CRISPR KO: sequence see Table S5 Yale Keck Oligonucleotide N/A Software and algorithms Trailmaker (split pipe v0.9.6) Parse Biosciences RRID:SCR_026736 R v4.4.1 R Project for Statistical Computing RRID:SCR_001905 Seurat v4 Butler et al.84 RRID:SCR_016341 Slingshot 2.14.0 Street et al.85 RRID:SCR_017012 CellChat 2.1.2 Jin et al.44 RRID:SCR_021946 Ingenuity Pathway Analysis QIAGEN RRID:SCR_008653 Cytoscape Shannon et al.86 RRID:SCR_003022 iRegulon Janky et al.39 http://iregulon.aertslab.org/ (Continued on next page) Cell Press Blue 1, 100001, February 1, 2026 e2 Article ll OPEN ACCESS
Staining:Article Title: ALK upregulates POSTN and WNT signaling to drive neuroblastoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER (+)-sodium L-ascorbate Sigma Aldrich Cat#: A4034 10% Neutral Buffered Formalin Sigma Aldrich Cat#: R04586-84 10x Tris-buffered saline (TBS) Bio-Rad Cat#: 1706435 10x Tris/Glycine/SDS Bio-Rad Cat#: 1610772 2-Mercaptoethanol Thermo Fisher Scientific Cat#: 21985023 4x Laemmli Sample Buffer Bio-Rad Cat#: 1610747 Accutase Innovative Cell Technologies Cat#: AT 104-500 B-27 Supplement (50X), without vitamin A Thermo Fisher Scientific Cat#: 17504-044 Bovine Serum Albumin (BSA) Sigma-Aldrich Cat#: A4612-1G Clarity Western ECL Substrate Bio-Rad Cat#: 1705061 Dulbecco’s phosphate-buffered saline (DPBS), no calcium, no magnesium Thermo Fisher Scientific Cat#: 14190144 Ethyl alcohol, Pure Sigma-Aldrich Cat#: E7023 EveryBlot Blocking Buffer Bio-Rad Cat#: 12010020 Fluoromount-GTM Mounting Medium, with DAPI Thermo Fisher Scientific Cat#: 00-4959-52 HaltTM Protease and Phosphatase Inhibitor Single-Use Cocktail (100X) Thermo Fisher Scientific Cat#: 78446 Heregulin b-1 Peprotech Cat#: 100-03 Mini-PROTEAN TGX Stain-Free Precast Gel Bio-Rad Cat#: 4568095 mTeSRTM1 StemCell technologies Cat#: 85850 N-2 Supplement (100X) Thermo Fisher Scientific Cat#: 17502048 NeurobasalTM-A Medium Thermo Fisher Scientific Cat#: 10888022 Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific Cat#: 15140122 PierceTM RIPA buffer Thermo Fisher Scientific Cat#: 89901 Retinoic acid Sigma-Aldrich Cat#: R2625 SsoAdvanced Universal SYBR Green Supermix Bio-Rad Cat#: 1725271 SuperScriptTM VILOTM Master Mix Thermo Fisher Scientific Cat#: 11755250 Trans-Blot Turbo 5x Transfer Buffer Bio-Rad Cat#: 10026938 Triton X-100 Sigma-Aldrich Cat#: X100 ATP (10mM) New England Biolabs Cat# P0756L T7 DNA ligase New England Biolabs Cat# M0318L T4 PNK New England Biolabs Cat# M0201L T4 ligase New England Biolabs Cat# M0202L Bbsi enzyme New England Biolabs Cat# R0539L DTT (1M) Thermo Fisher Scientific Cat# P2325 FastDigest Buffer (10x) Thermo Fisher Scientific Cat# B64 Critical commercial assays Quick RNA Miniprep Kit Zymo Research Cat#: 11-328 PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat#: 23225 Click-iTTM Plus EdU Alexa FluorTM 647 Flow Cytometry Assay Kit Thermo Fisher Scientific Cat#: C10635 Zyppy Plasmid Miniprep Kit Zymo Research Cat# D4037 Deposited data MYCN and ALK driven iPSC-basedtNCCs genomic data GEO: GSE228194 N/A Treehouse Childhood Cancer Initiative Compendium RNA-seq GEO: GSE129326 N/A TARGET Neuroblastoma datasets dbGaP ID: phs000467 N/A (Continued on next page) 12 Cell Reports 43, 113927, March 26, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Gabby Miller Kids First Pediatric Research: Neuroblastoma dbGaP ID: phs001436 N/A Experimental models: Cell lines WTC11 iPSC Kreitzer et al., 201335 N/A 1323 iPSC Matsumoto et al., 201722 N/A Experimental models: Organisms/strains NOD.Cg-Prkdcscid II2rg/Szj Jackson Labs Cat#005557; RRID: IMSR_JAX:005557 Oligonucleotides FN1 sgRNA (GGCCGGCTGTGCTGCACAGG) Integrated DNA Technologies N/A POSTN sgRNA (GGAGAAAACATGGGTAAAAA) Integrated DNA Technologies N/A B3GAT1/HNK1 qPCR F (TCATCACTGTCTGGCACCAG) Integrated DNA Technologies N/A B3GAT1/HNK1 qPCR R (CAGACGTGCAGTACTCCCTG) Integrated DNA Technologies N/A GAPDH qPCR F (CCATGGGGAAGGTGAAGGTC) Integrated DNA Technologies N/A GAPDH qPCR R (TGAAGGGGTCATTGATGGCA) Integrated DNA Technologies N/A NGFR/p75 qPCR F (GTGAGTGCTGCAAAGCCTG) Integrated DNA Technologies N/A NGFR/p75 qPCR R (CTCACCACGTCGGAGAACG) Integrated DNA Technologies N/A SOX9 qPCR F (GACGCTGGGCAAGCTCT) Integrated DNA Technologies N/A SOX9 qPCR R (GTAATCCGGGTGGTCCTTCT) Integrated DNA Technologies N/A TFAP2A qPCR F (ACTCGGAGACCTCTCGATCC) Integrated DNA Technologies N/A TFAP2A qPCR R (GGACACGGGGCCTTTCTTAA) Integrated DNA Technologies N/A Recombinant DNA pCDH-CAG-3xFLAG-MYCN-P2A-mScarletT2A-Luciferase Huang et al., 201621 N/A pCDH-CAG-ALKF1174L-EF1a-puromycin This paper N/A pCDH-CAG-(empty)-EF1a-puromycin This paper N/A pCDH-UCOE-TRE3G-3xFLAG-MYCNP2A-mScarlet-CAG-rtta3G-P2ALuciferase-T2A-blasticidin This paper N/A pCDH-UCOE-TRE3G-mScarlet-CAGrtta3G-P2A- Luciferase-T2A-blasticidin This paper N/A pCDH-U6-control sgRNA-CAG-BFP This paper N/A pCDH-U6-POSTN sgRNA-CAG-BFP This paper N/A pCDH-U6-FN1 sgRNA-CAG-BFP This paper N/A pCDH-CAG-dCas9-BFP-KRAB This paper N/A Software and algorithms STAR aligner v2.7.2a Dobin A et al., 201336 https://github.com/alexdobin/STAR/ N/A RSEM v1.2.1 Li B et al., 201137 https://github.com/deweylab/RSEM N/A R R Core/R Foundation N/A RTsne (R Package) The Comprehensive R Archive Network (CRAN) N/A DESeq2 (R Package) Love MI et al., 201438 Bioconductor N/A EnrichR Chen EY et al., 201339 The Comprehensive R Archive Network (CRAN) N/A singscore Foroutan M et al., 201844 Bioconductor N/A Cell Reports 43, 113927, March 26, 2024 13
SYBR Green Assay:Article Title: ALK upregulates POSTN and WNT signaling to drive neuroblastoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER (+)-sodium L-ascorbate Sigma Aldrich Cat#: A4034 10% Neutral Buffered Formalin Sigma Aldrich Cat#: R04586-84 10x Tris-buffered saline (TBS) Bio-Rad Cat#: 1706435 10x Tris/Glycine/SDS Bio-Rad Cat#: 1610772 2-Mercaptoethanol Thermo Fisher Scientific Cat#: 21985023 4x Laemmli Sample Buffer Bio-Rad Cat#: 1610747 Accutase Innovative Cell Technologies Cat#: AT 104-500 B-27 Supplement (50X), without vitamin A Thermo Fisher Scientific Cat#: 17504-044 Bovine Serum Albumin (BSA) Sigma-Aldrich Cat#: A4612-1G Clarity Western ECL Substrate Bio-Rad Cat#: 1705061 Dulbecco’s phosphate-buffered saline (DPBS), no calcium, no magnesium Thermo Fisher Scientific Cat#: 14190144 Ethyl alcohol, Pure Sigma-Aldrich Cat#: E7023 EveryBlot Blocking Buffer Bio-Rad Cat#: 12010020 Fluoromount-GTM Mounting Medium, with DAPI Thermo Fisher Scientific Cat#: 00-4959-52 HaltTM Protease and Phosphatase Inhibitor Single-Use Cocktail (100X) Thermo Fisher Scientific Cat#: 78446 Heregulin b-1 Peprotech Cat#: 100-03 Mini-PROTEAN TGX Stain-Free Precast Gel Bio-Rad Cat#: 4568095 mTeSRTM1 StemCell technologies Cat#: 85850 N-2 Supplement (100X) Thermo Fisher Scientific Cat#: 17502048 NeurobasalTM-A Medium Thermo Fisher Scientific Cat#: 10888022 Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific Cat#: 15140122 PierceTM RIPA buffer Thermo Fisher Scientific Cat#: 89901 Retinoic acid Sigma-Aldrich Cat#: R2625 SsoAdvanced Universal SYBR Green Supermix Bio-Rad Cat#: 1725271 SuperScriptTM VILOTM Master Mix Thermo Fisher Scientific Cat#: 11755250 Trans-Blot Turbo 5x Transfer Buffer Bio-Rad Cat#: 10026938 Triton X-100 Sigma-Aldrich Cat#: X100 ATP (10mM) New England Biolabs Cat# P0756L T7 DNA ligase New England Biolabs Cat# M0318L T4 PNK New England Biolabs Cat# M0201L T4 ligase New England Biolabs Cat# M0202L Bbsi enzyme New England Biolabs Cat# R0539L DTT (1M) Thermo Fisher Scientific Cat# P2325 FastDigest Buffer (10x) Thermo Fisher Scientific Cat# B64 Critical commercial assays Quick RNA Miniprep Kit Zymo Research Cat#: 11-328 PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat#: 23225 Click-iTTM Plus EdU Alexa FluorTM 647 Flow Cytometry Assay Kit Thermo Fisher Scientific Cat#: C10635 Zyppy Plasmid Miniprep Kit Zymo Research Cat# D4037 Deposited data MYCN and ALK driven iPSC-basedtNCCs genomic data GEO: GSE228194 N/A Treehouse Childhood Cancer Initiative Compendium RNA-seq GEO: GSE129326 N/A TARGET Neuroblastoma datasets dbGaP ID: phs000467 N/A (Continued on next page) 12 Cell Reports 43, 113927, March 26, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Gabby Miller Kids First Pediatric Research: Neuroblastoma dbGaP ID: phs001436 N/A Experimental models: Cell lines WTC11 iPSC Kreitzer et al., 201335 N/A 1323 iPSC Matsumoto et al., 201722 N/A Experimental models: Organisms/strains NOD.Cg-Prkdcscid II2rg/Szj Jackson Labs Cat#005557; RRID: IMSR_JAX:005557 Oligonucleotides FN1 sgRNA (GGCCGGCTGTGCTGCACAGG) Integrated DNA Technologies N/A POSTN sgRNA (GGAGAAAACATGGGTAAAAA) Integrated DNA Technologies N/A B3GAT1/HNK1 qPCR F (TCATCACTGTCTGGCACCAG) Integrated DNA Technologies N/A B3GAT1/HNK1 qPCR R (CAGACGTGCAGTACTCCCTG) Integrated DNA Technologies N/A GAPDH qPCR F (CCATGGGGAAGGTGAAGGTC) Integrated DNA Technologies N/A GAPDH qPCR R (TGAAGGGGTCATTGATGGCA) Integrated DNA Technologies N/A NGFR/p75 qPCR F (GTGAGTGCTGCAAAGCCTG) Integrated DNA Technologies N/A NGFR/p75 qPCR R (CTCACCACGTCGGAGAACG) Integrated DNA Technologies N/A SOX9 qPCR F (GACGCTGGGCAAGCTCT) Integrated DNA Technologies N/A SOX9 qPCR R (GTAATCCGGGTGGTCCTTCT) Integrated DNA Technologies N/A TFAP2A qPCR F (ACTCGGAGACCTCTCGATCC) Integrated DNA Technologies N/A TFAP2A qPCR R (GGACACGGGGCCTTTCTTAA) Integrated DNA Technologies N/A Recombinant DNA pCDH-CAG-3xFLAG-MYCN-P2A-mScarletT2A-Luciferase Huang et al., 201621 N/A pCDH-CAG-ALKF1174L-EF1a-puromycin This paper N/A pCDH-CAG-(empty)-EF1a-puromycin This paper N/A pCDH-UCOE-TRE3G-3xFLAG-MYCNP2A-mScarlet-CAG-rtta3G-P2ALuciferase-T2A-blasticidin This paper N/A pCDH-UCOE-TRE3G-mScarlet-CAGrtta3G-P2A- Luciferase-T2A-blasticidin This paper N/A pCDH-U6-control sgRNA-CAG-BFP This paper N/A pCDH-U6-POSTN sgRNA-CAG-BFP This paper N/A pCDH-U6-FN1 sgRNA-CAG-BFP This paper N/A pCDH-CAG-dCas9-BFP-KRAB This paper N/A Software and algorithms STAR aligner v2.7.2a Dobin A et al., 201336 https://github.com/alexdobin/STAR/ N/A RSEM v1.2.1 Li B et al., 201137 https://github.com/deweylab/RSEM N/A R R Core/R Foundation N/A RTsne (R Package) The Comprehensive R Archive Network (CRAN) N/A DESeq2 (R Package) Love MI et al., 201438 Bioconductor N/A EnrichR Chen EY et al., 201339 The Comprehensive R Archive Network (CRAN) N/A singscore Foroutan M et al., 201844 Bioconductor N/A Cell Reports 43, 113927, March 26, 2024 13
Bicinchoninic Acid Protein Assay:Article Title: ALK upregulates POSTN and WNT signaling to drive neuroblastoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER (+)-sodium L-ascorbate Sigma Aldrich Cat#: A4034 10% Neutral Buffered Formalin Sigma Aldrich Cat#: R04586-84 10x Tris-buffered saline (TBS) Bio-Rad Cat#: 1706435 10x Tris/Glycine/SDS Bio-Rad Cat#: 1610772 2-Mercaptoethanol Thermo Fisher Scientific Cat#: 21985023 4x Laemmli Sample Buffer Bio-Rad Cat#: 1610747 Accutase Innovative Cell Technologies Cat#: AT 104-500 B-27 Supplement (50X), without vitamin A Thermo Fisher Scientific Cat#: 17504-044 Bovine Serum Albumin (BSA) Sigma-Aldrich Cat#: A4612-1G Clarity Western ECL Substrate Bio-Rad Cat#: 1705061 Dulbecco’s phosphate-buffered saline (DPBS), no calcium, no magnesium Thermo Fisher Scientific Cat#: 14190144 Ethyl alcohol, Pure Sigma-Aldrich Cat#: E7023 EveryBlot Blocking Buffer Bio-Rad Cat#: 12010020 Fluoromount-GTM Mounting Medium, with DAPI Thermo Fisher Scientific Cat#: 00-4959-52 HaltTM Protease and Phosphatase Inhibitor Single-Use Cocktail (100X) Thermo Fisher Scientific Cat#: 78446 Heregulin b-1 Peprotech Cat#: 100-03 Mini-PROTEAN TGX Stain-Free Precast Gel Bio-Rad Cat#: 4568095 mTeSRTM1 StemCell technologies Cat#: 85850 N-2 Supplement (100X) Thermo Fisher Scientific Cat#: 17502048 NeurobasalTM-A Medium Thermo Fisher Scientific Cat#: 10888022 Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific Cat#: 15140122 PierceTM RIPA buffer Thermo Fisher Scientific Cat#: 89901 Retinoic acid Sigma-Aldrich Cat#: R2625 SsoAdvanced Universal SYBR Green Supermix Bio-Rad Cat#: 1725271 SuperScriptTM VILOTM Master Mix Thermo Fisher Scientific Cat#: 11755250 Trans-Blot Turbo 5x Transfer Buffer Bio-Rad Cat#: 10026938 Triton X-100 Sigma-Aldrich Cat#: X100 ATP (10mM) New England Biolabs Cat# P0756L T7 DNA ligase New England Biolabs Cat# M0318L T4 PNK New England Biolabs Cat# M0201L T4 ligase New England Biolabs Cat# M0202L Bbsi enzyme New England Biolabs Cat# R0539L DTT (1M) Thermo Fisher Scientific Cat# P2325 FastDigest Buffer (10x) Thermo Fisher Scientific Cat# B64 Critical commercial assays Quick RNA Miniprep Kit Zymo Research Cat#: 11-328 PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat#: 23225 Click-iTTM Plus EdU Alexa FluorTM 647 Flow Cytometry Assay Kit Thermo Fisher Scientific Cat#: C10635 Zyppy Plasmid Miniprep Kit Zymo Research Cat# D4037 Deposited data MYCN and ALK driven iPSC-basedtNCCs genomic data GEO: GSE228194 N/A Treehouse Childhood Cancer Initiative Compendium RNA-seq GEO: GSE129326 N/A TARGET Neuroblastoma datasets dbGaP ID: phs000467 N/A (Continued on next page) 12 Cell Reports 43, 113927, March 26, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Gabby Miller Kids First Pediatric Research: Neuroblastoma dbGaP ID: phs001436 N/A Experimental models: Cell lines WTC11 iPSC Kreitzer et al., 201335 N/A 1323 iPSC Matsumoto et al., 201722 N/A Experimental models: Organisms/strains NOD.Cg-Prkdcscid II2rg/Szj Jackson Labs Cat#005557; RRID: IMSR_JAX:005557 Oligonucleotides FN1 sgRNA (GGCCGGCTGTGCTGCACAGG) Integrated DNA Technologies N/A POSTN sgRNA (GGAGAAAACATGGGTAAAAA) Integrated DNA Technologies N/A B3GAT1/HNK1 qPCR F (TCATCACTGTCTGGCACCAG) Integrated DNA Technologies N/A B3GAT1/HNK1 qPCR R (CAGACGTGCAGTACTCCCTG) Integrated DNA Technologies N/A GAPDH qPCR F (CCATGGGGAAGGTGAAGGTC) Integrated DNA Technologies N/A GAPDH qPCR R (TGAAGGGGTCATTGATGGCA) Integrated DNA Technologies N/A NGFR/p75 qPCR F (GTGAGTGCTGCAAAGCCTG) Integrated DNA Technologies N/A NGFR/p75 qPCR R (CTCACCACGTCGGAGAACG) Integrated DNA Technologies N/A SOX9 qPCR F (GACGCTGGGCAAGCTCT) Integrated DNA Technologies N/A SOX9 qPCR R (GTAATCCGGGTGGTCCTTCT) Integrated DNA Technologies N/A TFAP2A qPCR F (ACTCGGAGACCTCTCGATCC) Integrated DNA Technologies N/A TFAP2A qPCR R (GGACACGGGGCCTTTCTTAA) Integrated DNA Technologies N/A Recombinant DNA pCDH-CAG-3xFLAG-MYCN-P2A-mScarletT2A-Luciferase Huang et al., 201621 N/A pCDH-CAG-ALKF1174L-EF1a-puromycin This paper N/A pCDH-CAG-(empty)-EF1a-puromycin This paper N/A pCDH-UCOE-TRE3G-3xFLAG-MYCNP2A-mScarlet-CAG-rtta3G-P2ALuciferase-T2A-blasticidin This paper N/A pCDH-UCOE-TRE3G-mScarlet-CAGrtta3G-P2A- Luciferase-T2A-blasticidin This paper N/A pCDH-U6-control sgRNA-CAG-BFP This paper N/A pCDH-U6-POSTN sgRNA-CAG-BFP This paper N/A pCDH-U6-FN1 sgRNA-CAG-BFP This paper N/A pCDH-CAG-dCas9-BFP-KRAB This paper N/A Software and algorithms STAR aligner v2.7.2a Dobin A et al., 201336 https://github.com/alexdobin/STAR/ N/A RSEM v1.2.1 Li B et al., 201137 https://github.com/deweylab/RSEM N/A R R Core/R Foundation N/A RTsne (R Package) The Comprehensive R Archive Network (CRAN) N/A DESeq2 (R Package) Love MI et al., 201438 Bioconductor N/A EnrichR Chen EY et al., 201339 The Comprehensive R Archive Network (CRAN) N/A singscore Foroutan M et al., 201844 Bioconductor N/A Cell Reports 43, 113927, March 26, 2024 13
Flow Cytometry:Article Title: ALK upregulates POSTN and WNT signaling to drive neuroblastoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER (+)-sodium L-ascorbate Sigma Aldrich Cat#: A4034 10% Neutral Buffered Formalin Sigma Aldrich Cat#: R04586-84 10x Tris-buffered saline (TBS) Bio-Rad Cat#: 1706435 10x Tris/Glycine/SDS Bio-Rad Cat#: 1610772 2-Mercaptoethanol Thermo Fisher Scientific Cat#: 21985023 4x Laemmli Sample Buffer Bio-Rad Cat#: 1610747 Accutase Innovative Cell Technologies Cat#: AT 104-500 B-27 Supplement (50X), without vitamin A Thermo Fisher Scientific Cat#: 17504-044 Bovine Serum Albumin (BSA) Sigma-Aldrich Cat#: A4612-1G Clarity Western ECL Substrate Bio-Rad Cat#: 1705061 Dulbecco’s phosphate-buffered saline (DPBS), no calcium, no magnesium Thermo Fisher Scientific Cat#: 14190144 Ethyl alcohol, Pure Sigma-Aldrich Cat#: E7023 EveryBlot Blocking Buffer Bio-Rad Cat#: 12010020 Fluoromount-GTM Mounting Medium, with DAPI Thermo Fisher Scientific Cat#: 00-4959-52 HaltTM Protease and Phosphatase Inhibitor Single-Use Cocktail (100X) Thermo Fisher Scientific Cat#: 78446 Heregulin b-1 Peprotech Cat#: 100-03 Mini-PROTEAN TGX Stain-Free Precast Gel Bio-Rad Cat#: 4568095 mTeSRTM1 StemCell technologies Cat#: 85850 N-2 Supplement (100X) Thermo Fisher Scientific Cat#: 17502048 NeurobasalTM-A Medium Thermo Fisher Scientific Cat#: 10888022 Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific Cat#: 15140122 PierceTM RIPA buffer Thermo Fisher Scientific Cat#: 89901 Retinoic acid Sigma-Aldrich Cat#: R2625 SsoAdvanced Universal SYBR Green Supermix Bio-Rad Cat#: 1725271 SuperScriptTM VILOTM Master Mix Thermo Fisher Scientific Cat#: 11755250 Trans-Blot Turbo 5x Transfer Buffer Bio-Rad Cat#: 10026938 Triton X-100 Sigma-Aldrich Cat#: X100 ATP (10mM) New England Biolabs Cat# P0756L T7 DNA ligase New England Biolabs Cat# M0318L T4 PNK New England Biolabs Cat# M0201L T4 ligase New England Biolabs Cat# M0202L Bbsi enzyme New England Biolabs Cat# R0539L DTT (1M) Thermo Fisher Scientific Cat# P2325 FastDigest Buffer (10x) Thermo Fisher Scientific Cat# B64 Critical commercial assays Quick RNA Miniprep Kit Zymo Research Cat#: 11-328 PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat#: 23225 Click-iTTM Plus EdU Alexa FluorTM 647 Flow Cytometry Assay Kit Thermo Fisher Scientific Cat#: C10635 Zyppy Plasmid Miniprep Kit Zymo Research Cat# D4037 Deposited data MYCN and ALK driven iPSC-basedtNCCs genomic data GEO: GSE228194 N/A Treehouse Childhood Cancer Initiative Compendium RNA-seq GEO: GSE129326 N/A TARGET Neuroblastoma datasets dbGaP ID: phs000467 N/A (Continued on next page) 12 Cell Reports 43, 113927, March 26, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Gabby Miller Kids First Pediatric Research: Neuroblastoma dbGaP ID: phs001436 N/A Experimental models: Cell lines WTC11 iPSC Kreitzer et al., 201335 N/A 1323 iPSC Matsumoto et al., 201722 N/A Experimental models: Organisms/strains NOD.Cg-Prkdcscid II2rg/Szj Jackson Labs Cat#005557; RRID: IMSR_JAX:005557 Oligonucleotides FN1 sgRNA (GGCCGGCTGTGCTGCACAGG) Integrated DNA Technologies N/A POSTN sgRNA (GGAGAAAACATGGGTAAAAA) Integrated DNA Technologies N/A B3GAT1/HNK1 qPCR F (TCATCACTGTCTGGCACCAG) Integrated DNA Technologies N/A B3GAT1/HNK1 qPCR R (CAGACGTGCAGTACTCCCTG) Integrated DNA Technologies N/A GAPDH qPCR F (CCATGGGGAAGGTGAAGGTC) Integrated DNA Technologies N/A GAPDH qPCR R (TGAAGGGGTCATTGATGGCA) Integrated DNA Technologies N/A NGFR/p75 qPCR F (GTGAGTGCTGCAAAGCCTG) Integrated DNA Technologies N/A NGFR/p75 qPCR R (CTCACCACGTCGGAGAACG) Integrated DNA Technologies N/A SOX9 qPCR F (GACGCTGGGCAAGCTCT) Integrated DNA Technologies N/A SOX9 qPCR R (GTAATCCGGGTGGTCCTTCT) Integrated DNA Technologies N/A TFAP2A qPCR F (ACTCGGAGACCTCTCGATCC) Integrated DNA Technologies N/A TFAP2A qPCR R (GGACACGGGGCCTTTCTTAA) Integrated DNA Technologies N/A Recombinant DNA pCDH-CAG-3xFLAG-MYCN-P2A-mScarletT2A-Luciferase Huang et al., 201621 N/A pCDH-CAG-ALKF1174L-EF1a-puromycin This paper N/A pCDH-CAG-(empty)-EF1a-puromycin This paper N/A pCDH-UCOE-TRE3G-3xFLAG-MYCNP2A-mScarlet-CAG-rtta3G-P2ALuciferase-T2A-blasticidin This paper N/A pCDH-UCOE-TRE3G-mScarlet-CAGrtta3G-P2A- Luciferase-T2A-blasticidin This paper N/A pCDH-U6-control sgRNA-CAG-BFP This paper N/A pCDH-U6-POSTN sgRNA-CAG-BFP This paper N/A pCDH-U6-FN1 sgRNA-CAG-BFP This paper N/A pCDH-CAG-dCas9-BFP-KRAB This paper N/A Software and algorithms STAR aligner v2.7.2a Dobin A et al., 201336 https://github.com/alexdobin/STAR/ N/A RSEM v1.2.1 Li B et al., 201137 https://github.com/deweylab/RSEM N/A R R Core/R Foundation N/A RTsne (R Package) The Comprehensive R Archive Network (CRAN) N/A DESeq2 (R Package) Love MI et al., 201438 Bioconductor N/A EnrichR Chen EY et al., 201339 The Comprehensive R Archive Network (CRAN) N/A singscore Foroutan M et al., 201844 Bioconductor N/A Cell Reports 43, 113927, March 26, 2024 13
Virus:Article Title: Rhinovirus triggers distinct host responses through differential engagement of epithelial innate immune signaling
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-human Gasdermin D (E5O4N) Cell Signaling Cat# 69469; RRID:AB_3697916 Sheep polyclonal anti-human NLRP1 R&D System Cat# AF6788; RRID:AB_10891878 Mouse monoclonal anti-human β-Actin (C4) Santa Cruz Cat# sc-47778; RRID:AB_626632 Goat anti-rabbit IgG Jackson ImmunoResearch Cat# 111-035-003; RRID:AB_2313567 Rabbit anti-sheep IgG ThermoFisher Cat# 31480; RRID:AB_228457 Goat anti-mouse IgG Jackson ImmunoResearch Cat# 115-035-003; RRID:AB_10015289 Mouse monoclonal anti-rhinovirus 16 (R16-7) QED Bioscience Cat# 18578; RRID:AB_3720294 Bacterial and virus strains Rhinovirus A1 ATCC Cat# VR-1559 psPAX2 Didier Trono Lab Cat# 12260; RRID:Addgene_12260 pMD2.G Didier Trono Lab Cat# 12259; RRID:Addgene_12259 lentiCRISPRv2GFP Walter et al.82 Cat# 82416; RRID:Addgene 82416 Biological samples Nasal mucosal surgical tissue Yale Tissue Procurement Service; https://medicine.yale.edu/ pathology/research/ypts/ N/A Chemicals, peptides, and recombinant proteins BX-795 Cayman Chemical Cat# 14932 TPCA-1 Cayman Chemical Cat# 15115 Ruxolitinib Cayman Chemical Cat# 11609 PneumaCult-Ex Plus Medium Stemcell Technologies Cat# 05040 PneumaCult-ALI Medium Stemcell Technologies Cat# 05001 BEGM Bronchial Epithelial Cell Growth Medium Lonza Cat# CC-3170 Opti-MEM Reduced Serum Medium Gibco Cat# 31985-070 DMEM, high glucose Gibco Cat# 11965-092 Human Recombinant IFN-β PBL Assay Science Cat# 11415 Human Recombinant IFN-λ1 R&D System Cat# 1598-IL Human Recombinant IL-1β PeproTech Cat# 200-01B QUANTI-Blue solution InvivoGen Cat# rep-qbs Ac-YVAD-CMK Cayman Chemical Cat# 10014 ZVAD(OMe)-CMK Cayman Chemical Cat# 14463 Disulfiram Cayman Chemical Cat# 15303 Rupintrivir (AG-7088) Sigma Aldrich Cat# PZ0315 MK-0608 Sigma Aldrich Cat# SML3200 Val-boroPro (talabostat) Millipore Sigma Cat# 53-146-50001 DharmaFECT transfection reagent Horizon Discovery Cat# T-2005-01 Glycine, Free Base RPI Research Products Cat# G36050 Pierce RIPA Buffer Thermo Scientific Cat# 89900 PhosSTOP Roche Cat# 04906845001 cOmplete Mini Protease Inhibitor Cocktail Roche Cat# 11697498001 Mini-PROTEAN TGX-Stain-Free Precast Gel Bio-Rad Cat# 4568084 EveryBlot Blocking Buffer Bio-Rad Cat# 12010020 TrypLE Express Enzyme Gibco Cat# 12604013 Polybrene Millipore Sigma Cat# TR-1003-G Clarity Western ECL substrate Bio-Rad Cat# 170-5061 (Continued on next page) e1 Cell Press Blue 1, 100001, February 1, 2026 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Aurum Total RNA Mini Kit Bio-Rad Cat# 7326820 iScript cDNA synthesis kit Bio-Rad Cat# 1708891 SYBR Green iTaq Universal mix Bio-Rad Cat# 1725124 LDH Cytotoxicity Assay Kit Cayman Chemical Cat# 610070 Evercode Whole Transcriptome Parse Biosciences https://www.parsebiosciences.com/ products/evercode-wt/ KAPA mRNA HyperPrep kit Roche Cat# 08098115702 Human CXCL10 DuoSet ELISA R&D Systems Cat# DY-266 Human IFN-λ1 DuoSet ELISA R&D Systems Cat# DY-7246 Human IL-1α DuoSet ELISA R&D Systems Cat# DY-200 Human IL-1β DuoSet ELISA R&D Systems Cat# DY-201 Human CXCL5 DuoSet ELISA R&D Systems Cat# DY-254 Human CXCL8 DuoSet ELISA R&D Systems Cat# DY-208 Human Cytokine/Chemokine 71-Plex Discovery Assay Eve Technologies Cat# HD-71 Pierce BCA Protein Assay Kit Thermo Scientific Cat# 23225 Deposited data Code and metadata to reproduce the scRNA-seq analysis This paper Mendeley data: 10.17632/2z5v5mvy4m.1 Rhinovirus A1 genome Genbank https://www.ncbi.nlm.nih.gov/ nuccore/KC894166.1 scRNASeq of HNEC ALI RV infection with BX795 This paper dbGAP:phs004417.v1.p1 Bulk RNA Seq of HNEC ALI RV infection with BX795 and TPCA1 This paper dbGAP:phs004417.v1.p1 scRNASeq of airway brushing from adult COVID19 patients Yoshida et al.83 https://www.covid19cellatlas.org/ Experimental models: Cell lines Primary Human Nasal Epithelial Cells Promocell Cat# 12620; H1 HeLa ATCC Cat# CRL-1958; HEK-Blue IFN-α/β reporter cells InvivoGen Cat# hkb-ifnabv2; RRID:CVCL_E8DB HEK-Blue IFN-λ reporter cells InvivoGen Cat# hbk-ifnlv2 HEK-Blue IL-1 reporter cells InvivoGen Cat# hkb-il1bv2; RRID:CVCL_E8DC Immortalized human bronchial epithelial cell BCi-NS1.1 Walter et al.63 RRID:CVCL_T029 HEK293T Abcam Cat# ab282205; RRID:CVCL_0063 Oligonucleotides qPCR primers: see Table S5 Yale Keck Oligonucleotide; https://medicine.yale.edu/ keck/oligo/ N/A Dharmacon siGENOME siRNA: see Table S5 Horizon Discovery N/A sgRNA for CRISPR KO: sequence see Table S5 Yale Keck Oligonucleotide N/A Software and algorithms Trailmaker (split pipe v0.9.6) Parse Biosciences RRID:SCR_026736 R v4.4.1 R Project for Statistical Computing RRID:SCR_001905 Seurat v4 Butler et al.84 RRID:SCR_016341 Slingshot 2.14.0 Street et al.85 RRID:SCR_017012 CellChat 2.1.2 Jin et al.44 RRID:SCR_021946 Ingenuity Pathway Analysis QIAGEN RRID:SCR_008653 Cytoscape Shannon et al.86 RRID:SCR_003022 iRegulon Janky et al.39 http://iregulon.aertslab.org/ (Continued on next page) Cell Press Blue 1, 100001, February 1, 2026 e2 Article ll OPEN ACCESS
Recombinant:Article Title: Rhinovirus triggers distinct host responses through differential engagement of epithelial innate immune signaling
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-human Gasdermin D (E5O4N) Cell Signaling Cat# 69469; RRID:AB_3697916 Sheep polyclonal anti-human NLRP1 R&D System Cat# AF6788; RRID:AB_10891878 Mouse monoclonal anti-human β-Actin (C4) Santa Cruz Cat# sc-47778; RRID:AB_626632 Goat anti-rabbit IgG Jackson ImmunoResearch Cat# 111-035-003; RRID:AB_2313567 Rabbit anti-sheep IgG ThermoFisher Cat# 31480; RRID:AB_228457 Goat anti-mouse IgG Jackson ImmunoResearch Cat# 115-035-003; RRID:AB_10015289 Mouse monoclonal anti-rhinovirus 16 (R16-7) QED Bioscience Cat# 18578; RRID:AB_3720294 Bacterial and virus strains Rhinovirus A1 ATCC Cat# VR-1559 psPAX2 Didier Trono Lab Cat# 12260; RRID:Addgene_12260 pMD2.G Didier Trono Lab Cat# 12259; RRID:Addgene_12259 lentiCRISPRv2GFP Walter et al.82 Cat# 82416; RRID:Addgene 82416 Biological samples Nasal mucosal surgical tissue Yale Tissue Procurement Service; https://medicine.yale.edu/ pathology/research/ypts/ N/A Chemicals, peptides, and recombinant proteins BX-795 Cayman Chemical Cat# 14932 TPCA-1 Cayman Chemical Cat# 15115 Ruxolitinib Cayman Chemical Cat# 11609 PneumaCult-Ex Plus Medium Stemcell Technologies Cat# 05040 PneumaCult-ALI Medium Stemcell Technologies Cat# 05001 BEGM Bronchial Epithelial Cell Growth Medium Lonza Cat# CC-3170 Opti-MEM Reduced Serum Medium Gibco Cat# 31985-070 DMEM, high glucose Gibco Cat# 11965-092 Human Recombinant IFN-β PBL Assay Science Cat# 11415 Human Recombinant IFN-λ1 R&D System Cat# 1598-IL Human Recombinant IL-1β PeproTech Cat# 200-01B QUANTI-Blue solution InvivoGen Cat# rep-qbs Ac-YVAD-CMK Cayman Chemical Cat# 10014 ZVAD(OMe)-CMK Cayman Chemical Cat# 14463 Disulfiram Cayman Chemical Cat# 15303 Rupintrivir (AG-7088) Sigma Aldrich Cat# PZ0315 MK-0608 Sigma Aldrich Cat# SML3200 Val-boroPro (talabostat) Millipore Sigma Cat# 53-146-50001 DharmaFECT transfection reagent Horizon Discovery Cat# T-2005-01 Glycine, Free Base RPI Research Products Cat# G36050 Pierce RIPA Buffer Thermo Scientific Cat# 89900 PhosSTOP Roche Cat# 04906845001 cOmplete Mini Protease Inhibitor Cocktail Roche Cat# 11697498001 Mini-PROTEAN TGX-Stain-Free Precast Gel Bio-Rad Cat# 4568084 EveryBlot Blocking Buffer Bio-Rad Cat# 12010020 TrypLE Express Enzyme Gibco Cat# 12604013 Polybrene Millipore Sigma Cat# TR-1003-G Clarity Western ECL substrate Bio-Rad Cat# 170-5061 (Continued on next page) e1 Cell Press Blue 1, 100001, February 1, 2026 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Aurum Total RNA Mini Kit Bio-Rad Cat# 7326820 iScript cDNA synthesis kit Bio-Rad Cat# 1708891 SYBR Green iTaq Universal mix Bio-Rad Cat# 1725124 LDH Cytotoxicity Assay Kit Cayman Chemical Cat# 610070 Evercode Whole Transcriptome Parse Biosciences https://www.parsebiosciences.com/ products/evercode-wt/ KAPA mRNA HyperPrep kit Roche Cat# 08098115702 Human CXCL10 DuoSet ELISA R&D Systems Cat# DY-266 Human IFN-λ1 DuoSet ELISA R&D Systems Cat# DY-7246 Human IL-1α DuoSet ELISA R&D Systems Cat# DY-200 Human IL-1β DuoSet ELISA R&D Systems Cat# DY-201 Human CXCL5 DuoSet ELISA R&D Systems Cat# DY-254 Human CXCL8 DuoSet ELISA R&D Systems Cat# DY-208 Human Cytokine/Chemokine 71-Plex Discovery Assay Eve Technologies Cat# HD-71 Pierce BCA Protein Assay Kit Thermo Scientific Cat# 23225 Deposited data Code and metadata to reproduce the scRNA-seq analysis This paper Mendeley data: 10.17632/2z5v5mvy4m.1 Rhinovirus A1 genome Genbank https://www.ncbi.nlm.nih.gov/ nuccore/KC894166.1 scRNASeq of HNEC ALI RV infection with BX795 This paper dbGAP:phs004417.v1.p1 Bulk RNA Seq of HNEC ALI RV infection with BX795 and TPCA1 This paper dbGAP:phs004417.v1.p1 scRNASeq of airway brushing from adult COVID19 patients Yoshida et al.83 https://www.covid19cellatlas.org/ Experimental models: Cell lines Primary Human Nasal Epithelial Cells Promocell Cat# 12620; H1 HeLa ATCC Cat# CRL-1958; HEK-Blue IFN-α/β reporter cells InvivoGen Cat# hkb-ifnabv2; RRID:CVCL_E8DB HEK-Blue IFN-λ reporter cells InvivoGen Cat# hbk-ifnlv2 HEK-Blue IL-1 reporter cells InvivoGen Cat# hkb-il1bv2; RRID:CVCL_E8DC Immortalized human bronchial epithelial cell BCi-NS1.1 Walter et al.63 RRID:CVCL_T029 HEK293T Abcam Cat# ab282205; RRID:CVCL_0063 Oligonucleotides qPCR primers: see Table S5 Yale Keck Oligonucleotide; https://medicine.yale.edu/ keck/oligo/ N/A Dharmacon siGENOME siRNA: see Table S5 Horizon Discovery N/A sgRNA for CRISPR KO: sequence see Table S5 Yale Keck Oligonucleotide N/A Software and algorithms Trailmaker (split pipe v0.9.6) Parse Biosciences RRID:SCR_026736 R v4.4.1 R Project for Statistical Computing RRID:SCR_001905 Seurat v4 Butler et al.84 RRID:SCR_016341 Slingshot 2.14.0 Street et al.85 RRID:SCR_017012 CellChat 2.1.2 Jin et al.44 RRID:SCR_021946 Ingenuity Pathway Analysis QIAGEN RRID:SCR_008653 Cytoscape Shannon et al.86 RRID:SCR_003022 iRegulon Janky et al.39 http://iregulon.aertslab.org/ (Continued on next page) Cell Press Blue 1, 100001, February 1, 2026 e2 Article ll OPEN ACCESS
Transfection:Article Title: Rhinovirus triggers distinct host responses through differential engagement of epithelial innate immune signaling
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-human Gasdermin D (E5O4N) Cell Signaling Cat# 69469; RRID:AB_3697916 Sheep polyclonal anti-human NLRP1 R&D System Cat# AF6788; RRID:AB_10891878 Mouse monoclonal anti-human β-Actin (C4) Santa Cruz Cat# sc-47778; RRID:AB_626632 Goat anti-rabbit IgG Jackson ImmunoResearch Cat# 111-035-003; RRID:AB_2313567 Rabbit anti-sheep IgG ThermoFisher Cat# 31480; RRID:AB_228457 Goat anti-mouse IgG Jackson ImmunoResearch Cat# 115-035-003; RRID:AB_10015289 Mouse monoclonal anti-rhinovirus 16 (R16-7) QED Bioscience Cat# 18578; RRID:AB_3720294 Bacterial and virus strains Rhinovirus A1 ATCC Cat# VR-1559 psPAX2 Didier Trono Lab Cat# 12260; RRID:Addgene_12260 pMD2.G Didier Trono Lab Cat# 12259; RRID:Addgene_12259 lentiCRISPRv2GFP Walter et al.82 Cat# 82416; RRID:Addgene 82416 Biological samples Nasal mucosal surgical tissue Yale Tissue Procurement Service; https://medicine.yale.edu/ pathology/research/ypts/ N/A Chemicals, peptides, and recombinant proteins BX-795 Cayman Chemical Cat# 14932 TPCA-1 Cayman Chemical Cat# 15115 Ruxolitinib Cayman Chemical Cat# 11609 PneumaCult-Ex Plus Medium Stemcell Technologies Cat# 05040 PneumaCult-ALI Medium Stemcell Technologies Cat# 05001 BEGM Bronchial Epithelial Cell Growth Medium Lonza Cat# CC-3170 Opti-MEM Reduced Serum Medium Gibco Cat# 31985-070 DMEM, high glucose Gibco Cat# 11965-092 Human Recombinant IFN-β PBL Assay Science Cat# 11415 Human Recombinant IFN-λ1 R&D System Cat# 1598-IL Human Recombinant IL-1β PeproTech Cat# 200-01B QUANTI-Blue solution InvivoGen Cat# rep-qbs Ac-YVAD-CMK Cayman Chemical Cat# 10014 ZVAD(OMe)-CMK Cayman Chemical Cat# 14463 Disulfiram Cayman Chemical Cat# 15303 Rupintrivir (AG-7088) Sigma Aldrich Cat# PZ0315 MK-0608 Sigma Aldrich Cat# SML3200 Val-boroPro (talabostat) Millipore Sigma Cat# 53-146-50001 DharmaFECT transfection reagent Horizon Discovery Cat# T-2005-01 Glycine, Free Base RPI Research Products Cat# G36050 Pierce RIPA Buffer Thermo Scientific Cat# 89900 PhosSTOP Roche Cat# 04906845001 cOmplete Mini Protease Inhibitor Cocktail Roche Cat# 11697498001 Mini-PROTEAN TGX-Stain-Free Precast Gel Bio-Rad Cat# 4568084 EveryBlot Blocking Buffer Bio-Rad Cat# 12010020 TrypLE Express Enzyme Gibco Cat# 12604013 Polybrene Millipore Sigma Cat# TR-1003-G Clarity Western ECL substrate Bio-Rad Cat# 170-5061 (Continued on next page) e1 Cell Press Blue 1, 100001, February 1, 2026 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Aurum Total RNA Mini Kit Bio-Rad Cat# 7326820 iScript cDNA synthesis kit Bio-Rad Cat# 1708891 SYBR Green iTaq Universal mix Bio-Rad Cat# 1725124 LDH Cytotoxicity Assay Kit Cayman Chemical Cat# 610070 Evercode Whole Transcriptome Parse Biosciences https://www.parsebiosciences.com/ products/evercode-wt/ KAPA mRNA HyperPrep kit Roche Cat# 08098115702 Human CXCL10 DuoSet ELISA R&D Systems Cat# DY-266 Human IFN-λ1 DuoSet ELISA R&D Systems Cat# DY-7246 Human IL-1α DuoSet ELISA R&D Systems Cat# DY-200 Human IL-1β DuoSet ELISA R&D Systems Cat# DY-201 Human CXCL5 DuoSet ELISA R&D Systems Cat# DY-254 Human CXCL8 DuoSet ELISA R&D Systems Cat# DY-208 Human Cytokine/Chemokine 71-Plex Discovery Assay Eve Technologies Cat# HD-71 Pierce BCA Protein Assay Kit Thermo Scientific Cat# 23225 Deposited data Code and metadata to reproduce the scRNA-seq analysis This paper Mendeley data: 10.17632/2z5v5mvy4m.1 Rhinovirus A1 genome Genbank https://www.ncbi.nlm.nih.gov/ nuccore/KC894166.1 scRNASeq of HNEC ALI RV infection with BX795 This paper dbGAP:phs004417.v1.p1 Bulk RNA Seq of HNEC ALI RV infection with BX795 and TPCA1 This paper dbGAP:phs004417.v1.p1 scRNASeq of airway brushing from adult COVID19 patients Yoshida et al.83 https://www.covid19cellatlas.org/ Experimental models: Cell lines Primary Human Nasal Epithelial Cells Promocell Cat# 12620; H1 HeLa ATCC Cat# CRL-1958; HEK-Blue IFN-α/β reporter cells InvivoGen Cat# hkb-ifnabv2; RRID:CVCL_E8DB HEK-Blue IFN-λ reporter cells InvivoGen Cat# hbk-ifnlv2 HEK-Blue IL-1 reporter cells InvivoGen Cat# hkb-il1bv2; RRID:CVCL_E8DC Immortalized human bronchial epithelial cell BCi-NS1.1 Walter et al.63 RRID:CVCL_T029 HEK293T Abcam Cat# ab282205; RRID:CVCL_0063 Oligonucleotides qPCR primers: see Table S5 Yale Keck Oligonucleotide; https://medicine.yale.edu/ keck/oligo/ N/A Dharmacon siGENOME siRNA: see Table S5 Horizon Discovery N/A sgRNA for CRISPR KO: sequence see Table S5 Yale Keck Oligonucleotide N/A Software and algorithms Trailmaker (split pipe v0.9.6) Parse Biosciences RRID:SCR_026736 R v4.4.1 R Project for Statistical Computing RRID:SCR_001905 Seurat v4 Butler et al.84 RRID:SCR_016341 Slingshot 2.14.0 Street et al.85 RRID:SCR_017012 CellChat 2.1.2 Jin et al.44 RRID:SCR_021946 Ingenuity Pathway Analysis QIAGEN RRID:SCR_008653 Cytoscape Shannon et al.86 RRID:SCR_003022 iRegulon Janky et al.39 http://iregulon.aertslab.org/ (Continued on next page) Cell Press Blue 1, 100001, February 1, 2026 e2 Article ll OPEN ACCESS
Protease Inhibitor:Article Title: Rhinovirus triggers distinct host responses through differential engagement of epithelial innate immune signaling
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-human Gasdermin D (E5O4N) Cell Signaling Cat# 69469; RRID:AB_3697916 Sheep polyclonal anti-human NLRP1 R&D System Cat# AF6788; RRID:AB_10891878 Mouse monoclonal anti-human β-Actin (C4) Santa Cruz Cat# sc-47778; RRID:AB_626632 Goat anti-rabbit IgG Jackson ImmunoResearch Cat# 111-035-003; RRID:AB_2313567 Rabbit anti-sheep IgG ThermoFisher Cat# 31480; RRID:AB_228457 Goat anti-mouse IgG Jackson ImmunoResearch Cat# 115-035-003; RRID:AB_10015289 Mouse monoclonal anti-rhinovirus 16 (R16-7) QED Bioscience Cat# 18578; RRID:AB_3720294 Bacterial and virus strains Rhinovirus A1 ATCC Cat# VR-1559 psPAX2 Didier Trono Lab Cat# 12260; RRID:Addgene_12260 pMD2.G Didier Trono Lab Cat# 12259; RRID:Addgene_12259 lentiCRISPRv2GFP Walter et al.82 Cat# 82416; RRID:Addgene 82416 Biological samples Nasal mucosal surgical tissue Yale Tissue Procurement Service; https://medicine.yale.edu/ pathology/research/ypts/ N/A Chemicals, peptides, and recombinant proteins BX-795 Cayman Chemical Cat# 14932 TPCA-1 Cayman Chemical Cat# 15115 Ruxolitinib Cayman Chemical Cat# 11609 PneumaCult-Ex Plus Medium Stemcell Technologies Cat# 05040 PneumaCult-ALI Medium Stemcell Technologies Cat# 05001 BEGM Bronchial Epithelial Cell Growth Medium Lonza Cat# CC-3170 Opti-MEM Reduced Serum Medium Gibco Cat# 31985-070 DMEM, high glucose Gibco Cat# 11965-092 Human Recombinant IFN-β PBL Assay Science Cat# 11415 Human Recombinant IFN-λ1 R&D System Cat# 1598-IL Human Recombinant IL-1β PeproTech Cat# 200-01B QUANTI-Blue solution InvivoGen Cat# rep-qbs Ac-YVAD-CMK Cayman Chemical Cat# 10014 ZVAD(OMe)-CMK Cayman Chemical Cat# 14463 Disulfiram Cayman Chemical Cat# 15303 Rupintrivir (AG-7088) Sigma Aldrich Cat# PZ0315 MK-0608 Sigma Aldrich Cat# SML3200 Val-boroPro (talabostat) Millipore Sigma Cat# 53-146-50001 DharmaFECT transfection reagent Horizon Discovery Cat# T-2005-01 Glycine, Free Base RPI Research Products Cat# G36050 Pierce RIPA Buffer Thermo Scientific Cat# 89900 PhosSTOP Roche Cat# 04906845001 cOmplete Mini Protease Inhibitor Cocktail Roche Cat# 11697498001 Mini-PROTEAN TGX-Stain-Free Precast Gel Bio-Rad Cat# 4568084 EveryBlot Blocking Buffer Bio-Rad Cat# 12010020 TrypLE Express Enzyme Gibco Cat# 12604013 Polybrene Millipore Sigma Cat# TR-1003-G Clarity Western ECL substrate Bio-Rad Cat# 170-5061 (Continued on next page) e1 Cell Press Blue 1, 100001, February 1, 2026 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Aurum Total RNA Mini Kit Bio-Rad Cat# 7326820 iScript cDNA synthesis kit Bio-Rad Cat# 1708891 SYBR Green iTaq Universal mix Bio-Rad Cat# 1725124 LDH Cytotoxicity Assay Kit Cayman Chemical Cat# 610070 Evercode Whole Transcriptome Parse Biosciences https://www.parsebiosciences.com/ products/evercode-wt/ KAPA mRNA HyperPrep kit Roche Cat# 08098115702 Human CXCL10 DuoSet ELISA R&D Systems Cat# DY-266 Human IFN-λ1 DuoSet ELISA R&D Systems Cat# DY-7246 Human IL-1α DuoSet ELISA R&D Systems Cat# DY-200 Human IL-1β DuoSet ELISA R&D Systems Cat# DY-201 Human CXCL5 DuoSet ELISA R&D Systems Cat# DY-254 Human CXCL8 DuoSet ELISA R&D Systems Cat# DY-208 Human Cytokine/Chemokine 71-Plex Discovery Assay Eve Technologies Cat# HD-71 Pierce BCA Protein Assay Kit Thermo Scientific Cat# 23225 Deposited data Code and metadata to reproduce the scRNA-seq analysis This paper Mendeley data: 10.17632/2z5v5mvy4m.1 Rhinovirus A1 genome Genbank https://www.ncbi.nlm.nih.gov/ nuccore/KC894166.1 scRNASeq of HNEC ALI RV infection with BX795 This paper dbGAP:phs004417.v1.p1 Bulk RNA Seq of HNEC ALI RV infection with BX795 and TPCA1 This paper dbGAP:phs004417.v1.p1 scRNASeq of airway brushing from adult COVID19 patients Yoshida et al.83 https://www.covid19cellatlas.org/ Experimental models: Cell lines Primary Human Nasal Epithelial Cells Promocell Cat# 12620; H1 HeLa ATCC Cat# CRL-1958; HEK-Blue IFN-α/β reporter cells InvivoGen Cat# hkb-ifnabv2; RRID:CVCL_E8DB HEK-Blue IFN-λ reporter cells InvivoGen Cat# hbk-ifnlv2 HEK-Blue IL-1 reporter cells InvivoGen Cat# hkb-il1bv2; RRID:CVCL_E8DC Immortalized human bronchial epithelial cell BCi-NS1.1 Walter et al.63 RRID:CVCL_T029 HEK293T Abcam Cat# ab282205; RRID:CVCL_0063 Oligonucleotides qPCR primers: see Table S5 Yale Keck Oligonucleotide; https://medicine.yale.edu/ keck/oligo/ N/A Dharmacon siGENOME siRNA: see Table S5 Horizon Discovery N/A sgRNA for CRISPR KO: sequence see Table S5 Yale Keck Oligonucleotide N/A Software and algorithms Trailmaker (split pipe v0.9.6) Parse Biosciences RRID:SCR_026736 R v4.4.1 R Project for Statistical Computing RRID:SCR_001905 Seurat v4 Butler et al.84 RRID:SCR_016341 Slingshot 2.14.0 Street et al.85 RRID:SCR_017012 CellChat 2.1.2 Jin et al.44 RRID:SCR_021946 Ingenuity Pathway Analysis QIAGEN RRID:SCR_008653 Cytoscape Shannon et al.86 RRID:SCR_003022 iRegulon Janky et al.39 http://iregulon.aertslab.org/ (Continued on next page) Cell Press Blue 1, 100001, February 1, 2026 e2 Article ll OPEN ACCESS
|
Bio-Rad is a verified supplier 
Bio-Rad manufactures this product 